takeharu nagai (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
takeharu nagai
Takeharu Nagai, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/takeharu+nagai/Kohinoor%2FpRSETb+(Plasmid+%2367770)/pmc12379806__SC-016-D5SC04491J-s002-65-42-44
Average 92 stars, based on 3 article reviews
Takeharu Nagai, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/takeharu+nagai/Kohinoor%2FpRSETb+(Plasmid+%2367770)/pmc12379806__SC-016-D5SC04491J-s002-65-42-44
Average 92 stars, based on 3 article reviews
takeharu nagai - by Bioz Stars,
2026-10
92/100 stars
Images
Related Articles
Sequencing:Article Title: The Positive Switching Fluorescent Protein Padron2 Enables Live-Cell Reversible Saturable Optical Linear Fluorescence Transitions (RESOLFT) Nanoscopy without Sequential Illumination Steps. Article Snippet: Padron, Padron2, and Kohinoor were expressed in One Shot TOP10 Electrocomp E. coli (Thermo Fisher) from the pBAD/HisB expression system. .. To this end, the coding sequence for Kohinoor was PCR amplified from Kohinoor/pRSETb (forward primer, AGGGCTCGAGCATGAGTGTGATTAAACC; reverse primer, AACGAATTCTTACTTGGCCTGCCT), which was a gift from Article Title: Conformational Change of the Hairpin-Like-Structured Robo2 Ectodomain Allows Nell1/2 Binding Article Snippet: Masaki Miyaguchi1, Yoichi Nakanishi1, Andrés D. Maturana1, Kimihiko Mizutani2, and Tomoaki Niimi1* 1Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan 2Graduate School of Agriculture, Kyoto University, Kyoto, Japan *Correspondence to be addressed to : Tomoaki Niimi, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan; tniimi@agr.nagoya-u.ac.jp; Tel.. 81- 52-789-5015 Abbreviations: ECD, ectodomain; EGFL, epidermal growth factor-like; FNIII, fibronectin type III; FRET, Förster resonance energy transfer; Ig, immunoglobulin-like; LG, laminin G; NELL, neural epidermal growth factor-like (NEL)-like; Robo, Roundabout; SEC, size exclusion chromatography; VWC, von Willebrand factor type C Electronic copy available at: https://ssrn.com/abstract=4115314 2 Article Title: Conformational Change of the Hairpin-like-structured Robo2 Ectodomain Allows NELL1/2 Binding. Article Snippet: .. Gamillus/ pcDNA3 was a gift from Polymerase Chain Reaction:Article Title: The Positive Switching Fluorescent Protein Padron2 Enables Live-Cell Reversible Saturable Optical Linear Fluorescence Transitions (RESOLFT) Nanoscopy without Sequential Illumination Steps. Article Snippet: Padron, Padron2, and Kohinoor were expressed in One Shot TOP10 Electrocomp E. coli (Thermo Fisher) from the pBAD/HisB expression system. .. To this end, the coding sequence for Kohinoor was PCR amplified from Kohinoor/pRSETb (forward primer, AGGGCTCGAGCATGAGTGTGATTAAACC; reverse primer, AACGAATTCTTACTTGGCCTGCCT), which was a gift from Amplification:Article Title: The Positive Switching Fluorescent Protein Padron2 Enables Live-Cell Reversible Saturable Optical Linear Fluorescence Transitions (RESOLFT) Nanoscopy without Sequential Illumination Steps. Article Snippet: Padron, Padron2, and Kohinoor were expressed in One Shot TOP10 Electrocomp E. coli (Thermo Fisher) from the pBAD/HisB expression system. .. To this end, the coding sequence for Kohinoor was PCR amplified from Kohinoor/pRSETb (forward primer, AGGGCTCGAGCATGAGTGTGATTAAACC; reverse primer, AACGAATTCTTACTTGGCCTGCCT), which was a gift from Plasmid Preparation:Article Title: The Positive Switching Fluorescent Protein Padron2 Enables Live-Cell Reversible Saturable Optical Linear Fluorescence Transitions (RESOLFT) Nanoscopy without Sequential Illumination Steps. Article Snippet: Padron, Padron2, and Kohinoor were expressed in One Shot TOP10 Electrocomp E. coli (Thermo Fisher) from the pBAD/HisB expression system. .. To this end, the coding sequence for Kohinoor was PCR amplified from Kohinoor/pRSETb (forward primer, AGGGCTCGAGCATGAGTGTGATTAAACC; reverse primer, AACGAATTCTTACTTGGCCTGCCT), which was a gift from Article Title: The linker histone chaperone Prothymosin α (PTMA) is essential for efficient DNA damage repair and the recruitment of PARP1. Article Snippet: Plasmid pPSmOrange was a gift from Vladislav Verkhusha (Addgene plasmid # 31898; RRID:31898). .. Plasmid SuperNova/pRSETB was a gift from Article Title: Conformational Change of the Hairpin-Like-Structured Robo2 Ectodomain Allows Nell1/2 Binding Article Snippet: Masaki Miyaguchi1, Yoichi Nakanishi1, Andrés D. Maturana1, Kimihiko Mizutani2, and Tomoaki Niimi1* 1Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan 2Graduate School of Agriculture, Kyoto University, Kyoto, Japan *Correspondence to be addressed to : Tomoaki Niimi, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan; tniimi@agr.nagoya-u.ac.jp; Tel.. 81- 52-789-5015 Abbreviations: ECD, ectodomain; EGFL, epidermal growth factor-like; FNIII, fibronectin type III; FRET, Förster resonance energy transfer; Ig, immunoglobulin-like; LG, laminin G; NELL, neural epidermal growth factor-like (NEL)-like; Robo, Roundabout; SEC, size exclusion chromatography; VWC, von Willebrand factor type C Electronic copy available at: https://ssrn.com/abstract=4115314 2 Article Title: Volumetric imaging of fast cellular dynamics with deep learning enhanced bioluminescence microscopy Article Snippet: .. CeNL-Clathrin_pEGFP, ReNL-Actin_pcDNA3, and Lyn-OeNL_pcDNA3 was a gift from Article Title: Conformational Change of the Hairpin-like-structured Robo2 Ectodomain Allows NELL1/2 Binding. Article Snippet: .. Gamillus/ pcDNA3 was a gift from Article Title: Ultrafast photophysics of a positive reversibly switchable fluorescent protein Article Snippet: .. Spectra were calibrated relative to the IR transmission of a pure polystyrene standard sample placed at the sample position. f.) Expression and Purification of Kohinoor The pRSETb plasmid that encoded the gene of Kohinoor with the N-terminal hexahistidine-tag was a gift from Construct:Article Title: The linker histone chaperone Prothymosin α (PTMA) is essential for efficient DNA damage repair and the recruitment of PARP1. Article Snippet: Plasmid pPSmOrange was a gift from Vladislav Verkhusha (Addgene plasmid # 31898; RRID:31898). .. Plasmid SuperNova/pRSETB was a gift from Article Title: Increased burden of rare risk variants across gene expression networks predisposes to sporadic Parkinson’s disease Article Snippet: Cy3-tagged siRNA (#SIC003–1NMOL, Sigma) was used as a positive control for transfection. .. ATeam1.03-nD/nA/pcDNA3 was a gift from Article Title: Increased burden of rare risk variants across gene expression networks predisposes to sporadic Parkinson's disease. Article Snippet: Cy3-tagged siRNA (#SIC003-1NMOL, Sigma) was used as a positive control for transfection. .. Constructs ATeam1.03-nD/nA/pcDNA3 was a gift from Subcloning:Article Title: The linker histone chaperone Prothymosin α (PTMA) is essential for efficient DNA damage repair and the recruitment of PARP1. Article Snippet: Plasmid pPSmOrange was a gift from Vladislav Verkhusha (Addgene plasmid # 31898; RRID:31898). .. Plasmid SuperNova/pRSETB was a gift from DNA Sequencing:Article Title: The linker histone chaperone Prothymosin α (PTMA) is essential for efficient DNA damage repair and the recruitment of PARP1. Article Snippet: Plasmid pPSmOrange was a gift from Vladislav Verkhusha (Addgene plasmid # 31898; RRID:31898). .. Plasmid SuperNova/pRSETB was a gift from Generated:Article Title: Conformational Change of the Hairpin-Like-Structured Robo2 Ectodomain Allows Nell1/2 Binding Article Snippet: Masaki Miyaguchi1, Yoichi Nakanishi1, Andrés D. Maturana1, Kimihiko Mizutani2, and Tomoaki Niimi1* 1Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan 2Graduate School of Agriculture, Kyoto University, Kyoto, Japan *Correspondence to be addressed to : Tomoaki Niimi, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan; tniimi@agr.nagoya-u.ac.jp; Tel.. 81- 52-789-5015 Abbreviations: ECD, ectodomain; EGFL, epidermal growth factor-like; FNIII, fibronectin type III; FRET, Förster resonance energy transfer; Ig, immunoglobulin-like; LG, laminin G; NELL, neural epidermal growth factor-like (NEL)-like; Robo, Roundabout; SEC, size exclusion chromatography; VWC, von Willebrand factor type C Electronic copy available at: https://ssrn.com/abstract=4115314 2 Article Title: Conformational Change of the Hairpin-like-structured Robo2 Ectodomain Allows NELL1/2 Binding. Article Snippet: .. Gamillus/ pcDNA3 was a gift from Inverse PCR:Article Title: Conformational Change of the Hairpin-Like-Structured Robo2 Ectodomain Allows Nell1/2 Binding Article Snippet: Masaki Miyaguchi1, Yoichi Nakanishi1, Andrés D. Maturana1, Kimihiko Mizutani2, and Tomoaki Niimi1* 1Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan 2Graduate School of Agriculture, Kyoto University, Kyoto, Japan *Correspondence to be addressed to : Tomoaki Niimi, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan; tniimi@agr.nagoya-u.ac.jp; Tel.. 81- 52-789-5015 Abbreviations: ECD, ectodomain; EGFL, epidermal growth factor-like; FNIII, fibronectin type III; FRET, Förster resonance energy transfer; Ig, immunoglobulin-like; LG, laminin G; NELL, neural epidermal growth factor-like (NEL)-like; Robo, Roundabout; SEC, size exclusion chromatography; VWC, von Willebrand factor type C Electronic copy available at: https://ssrn.com/abstract=4115314 2 Article Title: Conformational Change of the Hairpin-like-structured Robo2 Ectodomain Allows NELL1/2 Binding. Article Snippet: .. Gamillus/ pcDNA3 was a gift from Transmission Assay:Article Title: Ultrafast photophysics of a positive reversibly switchable fluorescent protein Article Snippet: .. Spectra were calibrated relative to the IR transmission of a pure polystyrene standard sample placed at the sample position. f.) Expression and Purification of Kohinoor The pRSETb plasmid that encoded the gene of Kohinoor with the N-terminal hexahistidine-tag was a gift from Expressing:Article Title: Ultrafast photophysics of a positive reversibly switchable fluorescent protein Article Snippet: .. Spectra were calibrated relative to the IR transmission of a pure polystyrene standard sample placed at the sample position. f.) Expression and Purification of Kohinoor The pRSETb plasmid that encoded the gene of Kohinoor with the N-terminal hexahistidine-tag was a gift from Purification:Article Title: Ultrafast photophysics of a positive reversibly switchable fluorescent protein Article Snippet: .. Spectra were calibrated relative to the IR transmission of a pure polystyrene standard sample placed at the sample position. f.) Expression and Purification of Kohinoor The pRSETb plasmid that encoded the gene of Kohinoor with the N-terminal hexahistidine-tag was a gift from |